Deletion with 25 nucleotides of TCRζ gene in T cells from a case with chronic myeloid leukemia
TCRζ is a transmembrane protein, a component of the T cell receptor (TCR)/CD3 complex, and plays a crucial role in T cell activation (1,2). Previous studies showed that T cell immunodeficiency might be related to decreased expression of TCRζ. The alternatively spliced isoforms of TCRζ 3' untranslated region (3' UTR) in patients with chronic myeloid leukemia (CML) was related to change of T cell activation gene expression pattern, and may be as a novel immunological marker for the evaluation of the CML immune status (3). Recently, we found that polymorphisms/mutations in the TCR ζ 3' UTR can regulate the expression level of TCR ζ (unpublished data). However, little is known the genetic alteration of TCRζ 3' UTR in T cells from patients with CML who showed T cell immunodeficiency. In this study, we investigated the mutations in the TCRζ 3' UTR in peripheral blood mononuclear cells (PBMCs) from 10 patients with de novo CML by RT-PCR, cloning and nucleotide sequencing (All human peripheral blood samples were collected with informed consent, and ethical approval was obtained from the Ethics Committee of the Medical School of Jinan University). Significant finding is that a deletion with 25 nucleotides located on 725–751 bp of TCRζ 3' UTR (727–751 del ACAGACTGTTGTCCCTGCACTCTTT) in a case with CML (Figure 1). According to TargetScan analysis, there are nine miRNA binding sites on the TCRζ 3' UTR, in which miR-132-3p/212-3p binding site is located between 730–736 bp of TCRζ 3' UTR, this binding site is included in the deleted segment with 25 nucleotides in the case (Figure 1). We further compared the expression level of TCRζ gene between this case and the control group including 9 cases with CML without TCRζ deletion by quantitative real-time PCR. The expression level of TCRζ in PBMCs from this case (median: 0.76) seemed high than that from control group (median: 0.25, n=9). Suggesting that miR-132-3p/212-3p may be one of the regulators for TCRζ, and the deletion may affect its function in T cells from this case. The genetic alteration of TCRζ gene was firstly reported in patients with systemic lupus erythematosus (SLE), which was thought to be related to the susceptibility for SLE. It was also firstly reported a 36 bp deletion of TCRζ gene (lacking exon 7), which might alter the signal transduction via TCR in T cells resulting aberrant T cell activation in SLE (2). Moreover, functional study indicated that mutations/polymorphisms and aberrant splicing of the downstream 3' UTR might affect the stability of TCR ζ mRNA, leading to TCRζ downregulation in T cells (4,5). In this study, we firstly identified the 25 bp deletion of TCRζ gene from patient with CML, the results may contribute for characterizing the T cell immune dysfunction in CML patients. It would be worth to further characterize the mutation, polymorphisms or splice variants in T cells from different hematological malignancies with T cell dysfunction, which might provide the information for reversing the immune dysfunction.
In conclusion, to our best knowledge, we firstly identified a 25 bp deletion of TCRζ 3’ UTR in CML patient, which involved in a predicted miRNA binding site, and might be related to the increased expression level of TCRζ gene as compensatory. However, the functional alteration in T cell activation is needed to further investigation.
Acknowledgements
Funding: This work was supported by grants from the National Natural Science Foundation of China (No. 81270604), the Guangdong Natural Science Foundation (No. S2013020012863), the Foundation for High-level Talents in Higher Education of Guangdong, China (No. [2013]246-54) and the Fundamental Research Funds for the Central Universities (No. 21616108).
Footnote
Conflicts of Interest: The authors have no conflicts of interest to declare.
References
- Li Y. Alterations in the expression pattern of TCR ζ chain in T cells from patients with hematological diseases. Hematology 2008;13:267-75. [Crossref] [PubMed]
- Stone JD, Harris DT, Soto CM, et al. A novel T cell receptor single-chain signaling complex mediates antigen-specific T cell activity and tumor control. Cancer Immunol Immunother 2014;63:1163-76. [Crossref] [PubMed]
- Zha X, Yan X, Shen Q, et al. Alternative expression of TCRζ related genes in the patients with chronic myeloid leukemia. J Hematol Oncol 2012;5:74. [Crossref] [PubMed]
- Nambiar MP, Enyedy EJ, Warke VG, et al. Polymorphisms/mutations of TCR-zeta-chain promoter and 3' untranslated region and selective expression of TCR zeta-chain with an alternatively spliced 3' untranslated region in patients with systemic lupus erythematosus. J Autoimmun 2001; 16:133-42. [Crossref] [PubMed]
- Li B, Guo L, Zhang Y, et al. Molecular alterations in the TCR signaling pathway in patients with aplastic anemia. J Hematol Oncol 2016;9:32. [Crossref] [PubMed]
Cite this article as: Li Y, Lai J, Liao Z, Guo L, Li B, Zhu K, Li Y. Deletion with 25 nucleotides of TCRζ gene in T cells from a case with chronic myeloid leukemia. Stem Cell Investig 2017;4:52.

